Query (optional)   in Class  

GrainGenes Probe Report: pTtksuA1

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuA1  [ Marker Report ]
Locus
Xksu-A1
[ Show all 26 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:AAGATTGTCAACAAGTGCC
L:CAACAGAGATATTGCCGTAG
Polymorphism
KSUA1 DraI
KSUA1 XbaI
KSUA1 EcoRI
KSUA1 EcoRV
KSUA1 HindIII
Linkage Group
7D / 7DS
Barley 1 (7H)
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.2
Clone Vector
pUC18
pUC
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Clone Authority
Gill, Bikram S.
Image
KSUA1 KO autoradiogram
KSUA1 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Kleinhofs, Andris96.05.08
Gill, Bikram S.92.09