Query (optional)   in Class  

GrainGenes Probe Report: pTtksuA3

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuA3  [ Marker Report ]
Locus
DGA3
[ Show all 17 ]
Type
Genomic
STS
PCR primers
R:GTATTATGGTCCATGTCTAC
L:AACATGGTCCTCAGGGAATC
Specificity
Primer specificity verified, maps on chromosome 5D.
Linkage Group
5D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.4
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09