Query (optional)   in Class  

GrainGenes Probe Report: pTtksuD19

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuD19  [ Marker Report ]
Locus
XksuD19
[ Show all 8 ]
Type
Genomic
STS
PCR primers
R:TGACCTCTTTGAGGACTGTC
L:TGTACATGGATTCAGACGAT
Polymorphism
KSUD19 XbaI
KSUD19 EcoRI
KSUD19 EcoRV
KSUD19 HindIII
KSUD19 DraI
Linkage Group
3D / 3DS,1
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.6
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUD19 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09