Query (optional)   in Class  

GrainGenes Probe Report: pTtksuE16

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuE16  [ Marker Report ]
Locus
XksuE16
[ Show all 6 ]
Type
Genomic
STS
PCR primers
R:CAGACATACATAGATGGAGGC
L:CACCATCGTGCAGATGGAGATC
Specificity
Primer specificity verified, maps on chromosome 2AL.
Polymorphism
KSUE16 EcoRV
[ Show all 6 ]
Linkage Group
2D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.2
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUE16 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09