Query (optional)   in Class  

GrainGenes Probe Report: pTtksuE18

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuE18  [ Marker Report ]
Locus
XksuE18-6B
[ Show all 27 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:TGAGCCGGTTGCTGTTCGTC
L:AAGCACCGACATGGTCACCC
Amplification Conditions
Anneal at 45oC
Polymorphism
KSUE18 DraI
KSUE18 HindIII
Linkage Group
1D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Source Tissue
leaf
Insert Size
1.5
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUE18 DraI SO autoradiogram
KSUE18 HindIII SO autoradiogram
Data Source
Talbert, Luther E.95.07.06
ATMI92.09
Gill, Bikram S.92.09