Query (optional)   in Class  

GrainGenes Probe Report: pTtksuE2

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuE2  [ Marker Report ]
Locus
XksuE2-4B
[ Show all 12 ]
Type
Genomic
STS
PCR primers
R:CTGATTTAGTCCTGTGGCAC
L:GTATTTCTACCATGGCTAGC
Specificity
Primer specificity verified, maps on chromosome 3BS.
Polymorphism
KSUE2 DraI
Linkage Group
3D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.5
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
Gill, Bikram S.
Image
KSUE2 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09