Query (optional)   in Class  

GrainGenes Probe Report: pTtksuE9

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuE9  [ Marker Report ]
Locus
XksuE9-7D
E009
XksuE9
Type
Genomic
STS
PCR primers
R:TTCACAAAATTCACCCAAGC
L:AAATCCAGCGGTATGCATGC
Linkage Group
4D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.7
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09