Query (optional)   in Class  

GrainGenes Probe Report: pTtksuF2

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuF2  [ Marker Report ]
Locus
ksuF2A
[ Show all 22 ]
Type
Genomic
STS
PCR primers
R:TTCGCCATTAGAGCAACCTG
L:GGAGATGGATTCCCTTGTCC
Polymorphism
KSUF2 DraI
Linkage Group
2D / 7D (5)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.3
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUF2 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09