Query (optional)   in Class  

GrainGenes Probe Report: pTtksuF37

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuF37  [ Marker Report ]
Locus
XksuF37-6A
[ Show all 9 ]
Type
Genomic
STS
PCR primers
R:CACAAAGACAAAGAACTAAT
L:TTCAGATTTTCACAGATTTA
Linkage Group
6D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09