Query (optional)   in Class  

GrainGenes Probe Report: pTtksuG10

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuG10  [ Marker Report ]
Locus
ksuG10
[ Show all 7 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:TGTCCAGCTTCAGCGAGTAC
L:GTGTTGATGTCCTTGAGGCC
Specificity
Primer specificity verified, maps on chromosomes 4A,4BL, 4DL.
Polymorphism
KSUG10 EcoRI
Linkage Group
4D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.3
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG10 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09