Query (optional)   in Class  

GrainGenes Probe Report: pTtksuG12

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuG12  [ Marker Report ]
Locus
XksuG12-4A
[ Show all 17 ]
Type
Genomic
STS
PCR primers
R:TATACTTCTGAGCTGCCGAG
L:CCAGTGTTGTAGTTCTCTAT
Polymorphism
KSUG12 EcoRI
KSUG12 EcoRV
KSUG12 DraI
KSUG12 HindIII
KSUG12 XbaI
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Clone Vector
pUC18
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG12 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
Gill, Bikram S.92.09