Query (optional)   in Class  

GrainGenes Probe Report: pTtksuG12

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuG12  [ Marker Report ]
Locus
[ Hide all but 1 of 17 ]
XksuG12-4A
XksuG12-7A
XksuG12-6B
XksuG12-5B
XksuG12-7B
XksuG12
HD012C22
HD014C5
D1.1_ctg3510
D1.1_ctg4478
G012a
G012b
XksuG12b
XksuG12a
XksuG12c
ksuG12
ksuG12-7A
Type
Genomic
STS
PCR primers
R:TATACTTCTGAGCTGCCGAG
L:CCAGTGTTGTAGTTCTCTAT
Polymorphism
KSUG12 EcoRI
KSUG12 EcoRV
KSUG12 DraI
KSUG12 HindIII
KSUG12 XbaI
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Clone Vector
pUC18
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG12 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
Gill, Bikram S.92.09