Query (optional)   in Class  

GrainGenes Probe Report: pTtksuG43

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuG43  [ Marker Report ]
Locus
DGG43
Xksu.DGG43
XksuG43
ksuG43
Type
Genomic
STS
PCR primers
R:ACCTTGTCGTGCATAGGAAC
L:GGCGCATGCACCAAAATGTT
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
0.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09