Query (optional)   in Class  

GrainGenes Probe Report: pTtksuG48

Probe
pTtksuG48  [ Marker Report ]
Locus
XksuG48-6B
[ Show all 14 ]
Synonym
Other nameDG G48
ReferenceMa Z-Q et al. (1993) RFLP markers linked to two Hessian fly-resistance genes in wheat (Triticum aestivum L.) from Triticum tauschii (coss.) Schmal. Theoretical and Applied Genetics 85:750-754.
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:CGGTAGGGCTCGTGCTCACC
L:AGGGAGGCTCGCTGGTTTTT
Polymorphism
KSUG48 EcoRV
Linkage Group
6D, 3D (2)
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.6
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG48 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09