Query (optional)   in Class  

GrainGenes Probe Report: pTtksuG49

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuG49  [ Marker Report ]
Locus
XksuG49-4A.2
[ Show all 12 ]
Type
Genomic
STS
PCR primers
R:CTGCTTCTCACTTGTTCATC
L:TTTACCCTCTGGTCATTGTA
Linkage Group
2D (4)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09