Query (optional)   in Class  

GrainGenes Probe Report: pTtksuG62

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuG62  [ Marker Report ]
Locus
ksuG62
[ Show all 15 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
L:TTAGAAGCAGGCTATGACCA
R:TACCATCAAGACGCCAGAAG
Linkage Group
3D (9)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.7
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09