Query (optional)   in Class  

GrainGenes Probe Report: pTtksuG9

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
pTtksuG9  [ Marker Report ]
Locus
KSUG9
[ Show all 17 ]
Type
Genomic
STS
PCR primers
R:GAGCCTGATGAAGACATTAC
L:CGAGTTAAGTCCTTGTATCG
Polymorphism
KSUG9 EcoRI
Linkage Group
1D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.4
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG9 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.