Query (optional)   in Class  

GrainGenes Probe Report: pTtksuH9

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuH9  [ Marker Report ]
Locus
XksuH9
[ Show all 27 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:GTGTATCACAAGCTTGCTGT
L:ATTGACCATTGCCCGGAGAA
Specificity
Primer specificity verified, maps on chromosome 2DL.
Polymorphism
KSUH9 HindIII
Linkage Group
2D, 1D (4)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.5
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUH9 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09