Query (optional)   in Class  

GrainGenes Probe Report: pTtksuI27

[ Printable Version ]  [ Submit comment/correction ]

Probe
pTtksuI27  [ Marker Report ]
Locus
XksuI27-1
[ Show all 17 ]
Type
Genomic
STS
PCR primers
R:GCACTTCCATATCGAGGTTG
L:GTACCATTGCTCAACTACAG
Polymorphism
KSUI27 DraI
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUI27 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09