Query (optional)   in Class  

GrainGenes Probe Report: scind00046

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
scind00046  [ Marker Report ]
Locus
scind00046.1Ha
scind00046.1Hb
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
Type
Indel
PCR primers
GAGCACGAGGATGAGAGGAG
TTTTACGGGATCAAAGCTGAG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.