GrainGenes Probe Report: scssr02748
[Submit comment/correction][What is a probe?]
Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.
| |
| |
| | Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. |
| | Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. |
| | Ramsay L et al. (2004) Variation shown by molecular markers in barley: genomic and genetic contraints Aspects of Applied Biology 72:146-154. |
|
|
| |
| GGTGCATTTGGAAGTCTAGG ATAGCAAGTGCCAAGTGAGC |
|