Query (optional)   in Class  

GrainGenes Probe Report: scssr09041

[ Printable Version ]  [ Submit comment/correction ]

Probe
scssr09041  [ Marker Report ]
Locus
scssr09041
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2004) Variation shown by molecular markers in barley: genomic and genetic contraints Aspects of Applied Biology 72:146-154.
Type
SSR
EST
PCR primers
CATGTCAGTGGGGTTCTAGC
TCTACTTGGACCTGCTGACC