Query (optional)   in Class  

GrainGenes Probe Report: 0090S

[ Printable Version ]  [ Submit comment/correction ]

Probe
0090S
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
PCR primers
Forward CCTACCGCTCCATAGTTGGTATCTA
Reverse ACACACACACACACACACATATATA