Query (optional)   in Class  

GrainGenes Probe Report: 1158-1F/1R

[ Printable Version ]  [ Submit comment/correction ]

Probe
1158-1F/1R
Reference
ReferencePal N et al. (2002) Development and characterization of microsatellite and RFLP-derived PCR markers in oat Crop Science 42:912-918.
Type
STS
PCR primers
1F 5' GCTCTTGGTACAGCAAAAGCCTTAGAGTA
1R 5' TCTCCACGGAATAGAAGGATCAACCA
STS size
> 380
Amplification Conditions
55
Specificity
Polymorphism among 13 Avena species is Yes
Source Species
Avena sp.