Query (optional)   in Class  

GrainGenes Probe Report: 1950-2F/2R

[ Printable Version ]  [ Submit comment/correction ]

Probe
1950-2F/2R
Reference
ReferencePal N et al. (2002) Development and characterization of microsatellite and RFLP-derived PCR markers in oat Crop Science 42:912-918.
Type
STS
PCR primers
2F 5' CCACCTACGTCGTCGGCGTCAATG
2F 5' GTCGCGGAACGCCTGGTTCACCTC
STS size
> 380
Amplification Conditions
55
Specificity
Polymorphism among 13 Avena species is Yes
Source Species
Avena sp.