Query (optional)   in Class  

GrainGenes Probe Report: 270S-1F/1R

[ Printable Version ]  [ Submit comment/correction ]

Probe
270S-1F/1R
Reference
ReferencePal N et al. (2002) Development and characterization of microsatellite and RFLP-derived PCR markers in oat Crop Science 42:912-918.
General Remarks
Insert contains repeats (AC)7
Type
STS
PCR primers
1F 5' ATTCTTGTTGGTGGTCGCTTGGTG
1R 5' AACTGCTACACCCACATACCCACAGG
STS size
183
Amplification Conditions
55
Specificity
Polymorphism among 13 Avena species is Not Determined
Source Species
Avena sp.