Query (optional)   in Class  

GrainGenes Probe Report: Vrn-D1

Probe
Vrn-D1
Locus
VRN-D1
Reference
ReferenceFu DL et al. (2005) Large deletions within the first intron in VRN-1 are associated with spring growth habit in barley and wheat Molecular Genetics and Genomics 273:54-65.
ReferenceMAS Wheat. Functional Markers for genes affecting agronomic traits in wheat MAS Wheat. Marker Assisted Selection in Wheat.
PCR primers
5' Intr1/D/F: GTTGTCTGCCTCATCAAATCC 3'
5' Intr1/D/R3: GGTCACTGGTGGTCTGTGC 3'