Query (optional)   in Class  

GrainGenes Probe Report: Vrn-H1

[ Printable Version ]  [ Submit comment/correction ]

Probe
Vrn-H1
Locus
VRN-H1
Reference
ReferenceFu DL et al. (2005) Large deletions within the first intron in VRN-1 are associated with spring growth habit in barley and wheat Molecular Genetics and Genomics 273:54-65.
ReferenceMAS Wheat. Functional Markers for genes affecting agronomic traits in wheat MAS Wheat. Marker Assisted Selection in Wheat.
PCR primers
5' Intr1/H/F1: GCTCCAGCTGATGAAACTCC 3'
5' Intr1/H/R1: CTTCATGGTTTTGCAAGCTCC 3'