Query (optional)   in Class  

GrainGenes Sequence Report: [Rcl378ct583cn906]

[ Printable Version ]  [ Submit comment/correction ]

Sequence
[Rcl378ct583cn906]
Probe
[Rcl378ct583cn906]
DNA
caaacactgtgacttngggtgagtnagtnagtnagtnaagaggaggaaga
tggggaagggagggaaaggagccgaggcggcggcggcggcggtggccgga
gccggtgaggaggagaacatggcggcgtggctggtggcgaagaacaccct
caagatcatgcccttcaagctcccgccagttgggccttatgatgtccgtg
tccggatgaaggcagtgggcatctgcggcagcgacgtgcactacctcagg
gagatgcgcattgcgcatttcgtggtgaaggagccgatggtgatcgggca
cgagtgcgccggcgtgatagaggaggtcggcagcggcgtgacgcacctcg
ccgtcggcgaccgcgtggcgctcgagcccggcatcagctgctggcgctgc
aggcactgcaagg
BLAST
BLAST Search