Query (optional)   in Class  

GrainGenes Sequence Report: 1DL_2243068

[Submit comment/correction]

Sequence
wsnp_Ex_c1130_2166731
Contig
1DL_2243068
Probe
wsnp_Ex_c1130_2166731
DNA Homology
1DL_2243068Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
01DL_2243068Best IWGSC match
DNA
ATGAACCCGACTCATACTTCTCGTCAGACGTCTTAGAATCATCATCTTCA
TTCTTGTCCCAAGATTTCTTGGCAACCATTTCACTGGCATCACCAGTGTC
RCCCATCTGATTATCCAAGTTGTCTTCACCCTCGCTGCCTGAGTCATTGC
TTTCATTCTCAGAAACATCAGCTAATTCAGCAGCAAAATCTCCTTCCATT
T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.