Query (optional)   in Class  

GrainGenes Sequence Report: 1DS_1904230

[Submit comment/correction]

Sequence
BS00022820_51
Contig
1DS_1904230
Species
Triticum aestivum
Probe
BS00022820_51
DNA Homology
1DS_1904230Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441DS_1904230Best IWGSC match
DNA
gcagtttgtcataagtttgtgacgagtgtttggattgtggctagtgatgg
Rataaaagaataagtcagacttaaaatctagctatatgtgattgtgaatt
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.