Query (optional)   in Class  

GrainGenes Sequence Report: 2AS_2099666

[Submit comment/correction]

Sequence
Excalibur_rep_c66982_126
Contig
2AS_2099666
Species
Triticum aestivum
Probe
Excalibur_rep_c66982_126
DNA Homology
2AS_2099666Best IWGSC match1741.99993e-41URGI_BestIWGSC_N
BLAST, e-value
1.99993e-412AS_2099666Best IWGSC match
DNA
aatagtcaagaagcttgatcgagtgtttgccgacacagtgaagcatcact
Ratatcgatggcgttgtcgacaagctacgttatcattgtacatcatagag
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.