Query (optional)   in Class  

GrainGenes Sequence Report: 2BS_5217416

[Submit comment/correction]

Sequence
wsnp_Ex_c19371_28311667
Contig
2BS_5217416
Probe
wsnp_Ex_c19371_28311667
DNA Homology
2BS_5217416Best IWGSC match3460URGI_BestIWGSC_N
BLAST, e-value
02BS_5217416Best IWGSC match
DNA
cctttcttcaacacatactgggtgcacaaaatcacaatgtaaatcagcgg
tgggcacaggagcaaaggtagcaaagacgcatgatttcaattcttMaatt
gccacacccacaccagcttccaatggtctagcaccatattttgtacagaa
aaagatattsaacatccttttctctgcatggtagttaccgcacgac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.