Query (optional)   in Class  

GrainGenes Sequence Report: 3B_10504729

[Submit comment/correction]

Sequence
BS00010849_51
Contig
3B_10504729
Probe
BS00010849_51
DNA Homology
3B_10504729Best IWGSC match1727.00005e-41URGI_BestIWGSC_N
BLAST, e-value
7.00005e-413B_10504729Best IWGSC match
DNA
agattgaatgcaaaagaaggcctaaaatgtctgaggtagtcaaggtcttg
Raaggtgccatgaatgcagagagcaacattgatcataacttcgttgcaac
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.