Query (optional)   in Class  

GrainGenes Sequence Report: 4AS_5937884

[Submit comment/correction]

Sequence
Tdurum_contig21233_82
Contig
4AS_5937884
Probe
Tdurum_contig21233_82
DNA Homology
4AS_5937884Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-424AS_5937884Best IWGSC match
DNA
ggcggcgacgccgccgccgccgatgatgatgatgaaaaattagctgaagt
Raaagattttcagtaacttcttataaaccactactactactactactagt
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.