Query (optional)   in Class  

GrainGenes Sequence Report: 5DS_2763522

[Submit comment/correction]

Sequence
Excalibur_c1110_390
Contig
5DS_2763522
Species
Triticum aestivum
Probe
Excalibur_c1110_390
DNA Homology
5DS_2763522Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445DS_2763522Best IWGSC match
DNA
tttcctcggacaagggcgatgaggccttccaaggaacggacctccacgcg
Magcatagatagggcgtcgatgatgtgatactcttcgatttcggtcaagg
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.