Query (optional)   in Class  

GrainGenes Sequence Report: 5DS_70827

[Submit comment/correction]

Sequence
D_contig21186_79
Contig
5DS_70827
Probe
D_contig21186_79
DNA Homology
5DS_70827Best IWGSC match3740URGI_BestIWGSC_N
BLAST, e-value
05DS_70827Best IWGSC match
DNA
tggtgaacaatgtgccaccactaaattgatggattaggtcggaggtcaaa
ggcgccatgatcttcgagagtagaccttgggtctcactcatgatttcgta
gttattctcatatgttgcaagcttcRgaggatgcacaagccttgcaacac
tagcttctcataggcctcctgaagttcatcattgcatggtcctggtgatg
gtag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.