Query (optional)   in Class  

GrainGenes Sequence Report: 5SrRNA Djatiroto

[ Printable Version ]  [ Submit comment/correction ]

Sequence
5SrRNA Djatiroto
Germplasm
Djatiroto (Saccharum)
Species
Saccharum spontaneum
Data Source
Pan, Yong-Bao99.04
Probe
5S rDNA PI/PII
Gene Class
5S ribosomal RNA
Remark
5S ribosomal fragment amplified from PI/PII PCR primers
Reference
ReferencePan Y-B and Burner DM (1998) Species-specific PCR markers for sugarcane and related taxa Plant & Animal Genome VI 87.
DNA
gtcgtgctggtatgatcgcatccgacataccttgcgtcctccttcctttt
atgcccgcgcctccgcgtccggcccgcccgtggcttcgccgcgccggttg
cccttccgccttccacctcgctcgcacggtgccgcctaggaaaacgaata
aaatttgactaacggacggccaaaaaccaatttttgaaaaaaaaatgaca
aacaaacaaaaaagggaatgcaacacgaggacttccca
BLAST
BLAST Search