Query (optional)   in Class  

GrainGenes Sequence Report: 6AL_5752894

[Submit comment/correction]

Sequence
wsnp_Ex_c7002_12063325
Contig
6AL_5752894
Probe
wsnp_Ex_c7002_12063325
DNA Homology
6AL_5752894Best IWGSC match3640URGI_BestIWGSC_N
BLAST, e-value
06AL_5752894Best IWGSC match
DNA
cgaagacacagacggagaagccgacgcagatccagccaagcgagaygacg
cgggtctcgccttggaaggcgaagacagtgaggagaaagatgagcccaaa
Rccggcgatgttgagtaggaggacgatcttggctgtgaaaatcttggcct
tcctgggggcgtagacgaggtacatgacgatgtagatggtctcgatgacg
c
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.