Query (optional)   in Class  

GrainGenes Sequence Report: 6AS_3653906

[Submit comment/correction]

Sequence
BobWhite_c20611_403
Contig
6AS_3653906
Probe
BobWhite_c20611_403
DNA Homology
6AS_3653906Best IWGSC match1265e-27URGI_BestIWGSC_N
BLAST, e-value
5e-276AS_3653906Best IWGSC match
DNA
tcaacaggggtagaatactgcctcgcacccagaagaatttctggtgctct
Rtaccataatgtcaccacctcgtgagtaaatgtccggacaggaatgccga
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.