Query (optional)   in Class  

GrainGenes Sequence Report: 6BL_3903173

[Submit comment/correction]

Sequence
RFL_Contig1105_1309
Contig
6BL_3903173
Species
Triticum aestivum
Probe
RFL_Contig1105_1309
DNA
acagaagctggcatgtacgccatccgcgcccgcaggaagactgtgactga
Raaggatttcctcgactcggtcaacaaggtcatcaaggggtaccagaaat
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.