Query (optional)   in Class  

GrainGenes Sequence Report: 6BL_4351594

[Submit comment/correction]

Sequence
BS00069116_51
Contig
6BL_4351594
Probe
BS00069116_51
DNA Homology
6BL_4351594Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446BL_4351594Best IWGSC match
DNA
agataagtgtttcaaaccaaaatgaacctgcaaatcaataccagctggca
Rgtggcgacaaacgtaccagagatcttgacccatgtagctagagcctcat
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.