Query (optional)   in Class  

GrainGenes Sequence Report: 6BL_4389762

[Submit comment/correction]

Sequence
tplb0021a17_853
Contig
6BL_4389762
Probe
tplb0021a17_853
DNA Homology
6BL_4389762Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446BL_4389762Best IWGSC match
DNA
aattaggcagccagtagatactgtacatatacagtgagcctcttcttcct
Mcccgctccgctgcacatacagtgagctcgtcgtctctgctccacttgta
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.