Query (optional)   in Class  

GrainGenes Sequence Report: 6DS_2049915

[Submit comment/correction]

Sequence
wsnp_Ku_c10377_17180909
Contig
6DS_2049915
Probe
wsnp_Ku_c10377_17180909
DNA Homology
6DS_2049915Best IWGSC match3570URGI_BestIWGSC_N
BLAST, e-value
06DS_2049915Best IWGSC match
DNA
cacccctctgttacgagttattcgtgcatcacgaatagcccaatgtgctt
ccaaaagcttcttgcgccattggaaaatggatttcagctgcttctctctc
Ratgccttttgcatctgctgaacttgccttataagctcgacgcgttggcg
ctcgcattgcttgacaaacttcctgtatatcctatcaggcatcgccatta
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.