Query (optional)   in Class  

GrainGenes Sequence Report: 6DS_2075973

[Submit comment/correction]

Sequence
CAP8_c2184_62
Contig
6DS_2075973
Probe
CAP8_c2184_62
DNA Homology
6DS_2075973Best IWGSC match1397e-31URGI_BestIWGSC_N
BLAST, e-value
7e-316DS_2075973Best IWGSC match
DNA
cagcttccttgtgtgggaatatgaacttctccatgaataccttcggagtc
Rccgcgactgcataatagtaatcccggccgtaaggtaccactctcgcttg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.