Query (optional)   in Class  

GrainGenes Sequence Report: 7AL_1182583

[Submit comment/correction]

Sequence
wsnp_Ex_c6142_10746442
Contig
7AL_1182583
Probe
wsnp_Ex_c6142_10746442
DNA Homology
7AL_1182583Best IWGSC match2110URGI_BestIWGSC_N
BLAST, e-value
07AL_1182583Best IWGSC match
DNA
gtgccaggcgtgctgcctctctttctcgctccctcttcttccttaattct
tcatctaacttgaactgtgcagcagcttcagcggccttcacctgggcttc
Ratcctttctttctcttcttgctgccttttttccagcctctccttttcca
actgtaattttgcagggtctatttgctgcccatggtccagaagtgccttc
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.