Query (optional)   in Class  

GrainGenes Sequence Report: AA231719

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AA231719
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Avena sativa (oat)
Keyword
EST
Species
Avena sativa
Cultivar
Brooks
Clone Library
cDNA from oat
Tissue
etiolated leaf
Data Source
genbankRelease 141, Apr 15 2004
genbankDownloaded 2008-2009
Title
CDO795.R cDNA from oat Avena sativa cDNA clone CDO795, mRNA sequence.
Clone
CDO795
Probe
CDO795
Remark
DB_xref: taxon:4498
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Locus Comment: Contact: McCouch SR; Dept Plant Breeding; Cornell University; Ithaca, NY 14853-1901, USA; Tel: 607 255 0420; Fax: 607 255 6683; Email: srm4@cornell.edu; cDNA from oat (Avena sativa); reverse sequence of RFLP probe; CDO795. Sequence determined by Nicola M. Ayres and Hongyong Fu. For; mapping information, additional citations and other related; information concerning this probe, please refer to the RiceGenes; database at; http:
Note: Vector: Uni-ZAP XR/pBluescript; Site_1: EcoRI; Site_2: XhoI; A Uni-ZAP XR cDNA library was constructed from etiolated leaf mRNA from the oat cultivar 'Brooks' and converted to pBluescript (amp resistant) as described in Heun et al. (1991) Genome 34:437-447. For insert amplification, use M13 forward and reverse primers. Clones from this library are designated with the prefix 'CDO'. *Note: Clone CDO1081 was recloned into the TA cloning vector and carries kanamycin resistance.
DNA
ggaccatctctggcatgttggggctgcttccatctgatcagttccgtgtt
gttgtagaagccctttggagtccgttcttcaagttattggtatcctcaat
catgactgggtatactctacgaaatgctgagtataggctatcttttgaaa
ggaacctagaactttccgaagaagatgctgaatatcataacagagacatc
agtg
BLAST
BLAST Search