Query (optional)   in Class  

GrainGenes Sequence Report: ABC152-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
ABC152-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
ABC152
DNA Homology
RICC0425A664rice_EST
[ Show all 422 ]
DNA
ctccaccggcggcaaggccccccgcaagcagctcgccaccaaggcggcga
ggaagtcggcgccgaccaccggcggcgtgaagaagcctcaccgctacagg
cccgggaccgtggcgctccgcgagatccgcaagtaccagaagagcaccga
BLAST
BLAST Search