Query (optional)   in Class  

GrainGenes Sequence Report: ABC154-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
ABC154-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
ABC154
DNA Homology
AC003976121noncereal_BlastN
DNA
ctttttttttttttttttaccaacggacaacggccaacaaatctactcat
caggttcagcagtgtttacactcaaaaaaaaaaaaaggttcagcagtgtt
caaaagacccaatcacatagcataccaacaagcaaaattcaaagaggctg
caattgagggcaggctcgcattgcacgacacaacagaatatgacaacaca
cgccagtcacgggcacaatatgaaaacgatgaaatgaaacgccagtctaa
tctgacaagggaagtgttcaatgacatgctgctttattttcg
BLAST
BLAST Search