Query (optional)   in Class  

GrainGenes Sequence Report: ABC158

[ Printable Version ]  [ Submit comment/correction ]

Sequence
ABC158
Text sequence
CCTTGAGTCTGCAACATTAACAACACCAAACAATCTGGGAAGTTGGCTACAGTTCAGCTC
AAAACAGAGGACAACGATACACATTCTTCTAAAGTTCCTTACAAAATTTATGAAAATGAT
ATCCTAAGGAGGTTGGTACGAAATTTTGAAGTGGTTACAATCAGCTCGATTCAGCAGGGC
AGTACACACATCATCTAATCAGACTGGCACTGTGATGTGTATTCGCTATGCAGATCTCAG
TC...TCACATTGAGACTCAGGAGTCGTCTATCGAGTACCTGTGTTGGTGATATACATGA
TGACACCAGACTTCTATCTCCTCTTAATCTCTATCGCAAGTGGCAACAATGTAGCATTTG
TGCTGAGTAATTCTCTCAACAATACAGTCATCAGCATAAGTTCCCTTGTGTGTGCACGCT
AATCTCTGGAACCTAGGGTCCTTCGCAATTCTCAACGCAACACGGTATTTTTGTCCTAGC
TTTTCAG
Data Source
Blake, Tom94.09.14
Probe
ABC158
Remark
BREAK AT 240
'...' identifies a gap of unknown size.
Sequence runs 5'->3' from the universal primer.